Journal: Pharmaceutics

Article Title: Lactoferrin Binding to SARS-CoV-2 Spike Glycoprotein Blocks Pseudoviral Entry and Relieves Iron Protein Dysregulation in Several In Vitro Models

doi: 10.3390/pharmaceutics14102111

Figure Lengend Snippet: Protective effect of bovine lactoferrin (bLf) against iron and inflammatory disorders induced by SARS-CoV-2 Spike glycoprotein on Caco-2 cells. Western blot (panel ( a )) and densitometry analysis of ferroportin (Fpn) ( b ), hephaestin (Heph) ( c ), transferrin receptor 1 (TfR1) ( d ), DMT-1 ( e ) and ferritin (Ftn) ( f ) levels in Caco-2 cells untreated or treated with 20 nM Spike glycoprotein in the absence or presence of 1.25 μM bLf. See text for details. Error bars: standard error of the mean. Statistical significance is indicated as follows: *: p < 0.05; **: p < 0.01; ***: p < 0.001 (one-way ANOVA with post-hoc Tukey test).

Article Snippet: For experiments on the contribution of TfR1 to pseudoviral fusion to the cell membrane, two different approaches were followed: (i) cells were preincubated with an antibody against human TfR1 (sc-32272, Santa Cruz, CA, USA) for 1 h at 37 °C.

Techniques: Western Blot

Journal: Pharmaceutics

Article Title: Lactoferrin Binding to SARS-CoV-2 Spike Glycoprotein Blocks Pseudoviral Entry and Relieves Iron Protein Dysregulation in Several In Vitro Models

doi: 10.3390/pharmaceutics14102111

Figure Lengend Snippet: Protective effect of bovine lactoferrin (bLf) against iron and inflammatory disorders induced by SARS-CoV-2 Spike glycoprotein on THP-1 cells. Western blot ( a ) and densitometry analysis of ferroportin (Fpn) ( b ), membrane-bound ceruloplasmin (Cp) ( c ), transferrin receptor 1 (TfR1) ( d ) and ferritin (Ftn) ( e ) levels and ELISA quantitation of IL-1β and IL-6 production ( f ) in THP-1 cells untreated or treated with 20 nM Spike glycoprotein in the absence or presence of 1.25 μM bLf. See text for details. Error bars: standard error of the mean. Statistical significance is indicated as follows: *: p < 0.05; **: p < 0.01; ***: p < 0.001 (one-way ANOVA with post-hoc Tukey test).

Article Snippet: For experiments on the contribution of TfR1 to pseudoviral fusion to the cell membrane, two different approaches were followed: (i) cells were preincubated with an antibody against human TfR1 (sc-32272, Santa Cruz, CA, USA) for 1 h at 37 °C.

Techniques: Western Blot, Membrane, Enzyme-linked Immunosorbent Assay, Quantitation Assay

Journal: Pharmaceutics

Article Title: Lactoferrin Binding to SARS-CoV-2 Spike Glycoprotein Blocks Pseudoviral Entry and Relieves Iron Protein Dysregulation in Several In Vitro Models

doi: 10.3390/pharmaceutics14102111

Figure Lengend Snippet: Luminescence of Pseudovirus observed in in 16HBE14o- ( a ), Caco-2 ( b ) and THP-1 ( c ) cells infected at multiplicity of infection (MOI) of 10 in the presence or absence of 200 nM monoclonal antibody recognizing the ectodomains of human transferrin receptor 1 (TfR1) (anti-TfR1) or 200 nM soluble human TfR1 (sTfR1). See text for details. Data represent the mean values of three independent experiments. Error bars: standard error of the mean. Statistical significance is indicated as follows: *: p < 0.05; **: p < 0.01; ***: p < 0.001 (one-way ANOVA with post-hoc Tukey test). RLU = Relative Luminescence Units.

Article Snippet: For experiments on the contribution of TfR1 to pseudoviral fusion to the cell membrane, two different approaches were followed: (i) cells were preincubated with an antibody against human TfR1 (sc-32272, Santa Cruz, CA, USA) for 1 h at 37 °C.

Techniques: Infection

Journal: Pharmaceutics

Article Title: Lactoferrin Binding to SARS-CoV-2 Spike Glycoprotein Blocks Pseudoviral Entry and Relieves Iron Protein Dysregulation in Several In Vitro Models

doi: 10.3390/pharmaceutics14102111

Figure Lengend Snippet: ( a ) Complex between human lactoferrin (hLf) (in red) and transferrin receptor 1 (TfR1) (in grey) obtained through molecular docking simulations. ( b ) Superposition of the hLf-TfR1 docking pose with the Tf-TfR1 crystallographic structure (PDB ID: 3S9L).

Article Snippet: For experiments on the contribution of TfR1 to pseudoviral fusion to the cell membrane, two different approaches were followed: (i) cells were preincubated with an antibody against human TfR1 (sc-32272, Santa Cruz, CA, USA) for 1 h at 37 °C.

Techniques:

Journal: Pharmaceutics

Article Title: Lactoferrin Binding to SARS-CoV-2 Spike Glycoprotein Blocks Pseudoviral Entry and Relieves Iron Protein Dysregulation in Several In Vitro Models

doi: 10.3390/pharmaceutics14102111

Figure Lengend Snippet: Comparison between the transferrin and transferrin receptor 1 (Tf-TfR1) crystallographic structures (PDB ID: 3S9L) and the obtained human lactoferrin (hLf)-TfR1 docking pose. Both TfR1 monomers are represented in grey; Tf is represented by a blue transparent surface bound to TfR1 monomer A, while hLf is in red bound on TfR1 monomer B. Both TfR1 monomers are equivalent for sequence, structure and interactions, Tf and hLf can therefore occupy the same location.

Article Snippet: For experiments on the contribution of TfR1 to pseudoviral fusion to the cell membrane, two different approaches were followed: (i) cells were preincubated with an antibody against human TfR1 (sc-32272, Santa Cruz, CA, USA) for 1 h at 37 °C.

Techniques: Comparison, Sequencing

Journal: Pharmaceutics

Article Title: Lactoferrin Binding to SARS-CoV-2 Spike Glycoprotein Blocks Pseudoviral Entry and Relieves Iron Protein Dysregulation in Several In Vitro Models

doi: 10.3390/pharmaceutics14102111

Figure Lengend Snippet: Hydrogen bonds, salt bridges and non-polar interactions established between transferrin receptor 1 (TfR1) (monomer A and B) and human lactoferrin (hLf) or bovine lactoferrin (bLf). TfR1 residues highlighted in grey are also contacted by Tf in the Tf-TfR1 crystallographic structure (PDB ID: 3S9L).

Article Snippet: For experiments on the contribution of TfR1 to pseudoviral fusion to the cell membrane, two different approaches were followed: (i) cells were preincubated with an antibody against human TfR1 (sc-32272, Santa Cruz, CA, USA) for 1 h at 37 °C.

Techniques:

Journal: Pharmaceutics

Article Title: Lactoferrin Binding to SARS-CoV-2 Spike Glycoprotein Blocks Pseudoviral Entry and Relieves Iron Protein Dysregulation in Several In Vitro Models

doi: 10.3390/pharmaceutics14102111

Figure Lengend Snippet: Complex obtained between bovine lactoferrin (bLf) (in blue) and human transferrin receptor 1 (TfR1) (in grey). The apical domain of TfR1, binding site of bLf, is highlighted in red. A closer representation of the interaction site is shown in the right image, where the proteins are represented as a solid surface, except for the interacting regions that are shown as cartoons.

Article Snippet: For experiments on the contribution of TfR1 to pseudoviral fusion to the cell membrane, two different approaches were followed: (i) cells were preincubated with an antibody against human TfR1 (sc-32272, Santa Cruz, CA, USA) for 1 h at 37 °C.

Techniques: Binding Assay

Journal: Mediators of Inflammation

Article Title: TLR2 Derangements Likely Play a Significant Role in the Inflammatory Response and Thrombosis in Patients with Ph (−) Classical Myeloproliferative Neoplasm

doi: 10.1155/2024/1827127

Figure Lengend Snippet: (a) Blood TLR2 levels were elevated in PV or MPN (ET, PV, and MF grouped as MPN). TLR2 levels were measured by flow cytometry (MFI). One hundred nineteen MPN patients (51 ET, 37 PV, 31MF (including eight post-ET MF, eight post-PV-MF, and 15 PMF)) were compared with 21 normal volunteer controls. The mean TLR2 values were ET (290.6 ± 9.8), PV (358.5 ± 26.01), MF (231.3 ± 9.89), and controls (220.6 ± 9.8). TLR2 was significantly elevated in the PV ( P < 0.001), ET ( P < 0.01), and MPN (grouping ET, PV, and MF together as MPN) ( P < 0.01) relative to the controls. MF was not significantly different from controls. Pairwise comparison the three MPN, ET was less than PV ( P < 0.01), and PV ( P < 0.001) and ET ( P < 0.05) were more than MF. (b) Patients with elevated TLR2 level (values more than 2 standard devation of controls) have increased TLR2 expression in CD34 + , CD3 + , CD14 + , CD71 + , and CD20 + cells; CD41 + cells were not over expressed. (c) TLR4 levels were not significantly elevated in PV, ET, or MF compared to controls but were significantly elevated when PV, ET, and MF were grouped as MPN. TLR4 was measured by flow cytometry (MFI). Sixty MPN patients were studied, including 20 ET, 25 PV, 15 MF, and 19 controls. The mean TLR4 values were ET (213.2 ± 9.8), PV (227.5 ± 7.9), MF (223.6 ± 11.2), and controls (200.1 ± 7.2). There were no significant differences when comparing the ET, PV, and MF groups to the controls, but when ET, PV, and MF were grouped as MPN, a significant difference was detected ( P =0.04).

Article Snippet: Fluorescence-conjugated anti-CD3, CD14, CD20, CD34, CD41, and CD71 antibodies (Miltenyi Biotec, Auburn, CA) were used to gate and identify different cell populations.

Techniques: Flow Cytometry, Comparison, Expressing

Journal: American Journal of Cancer Research

Article Title: HMGB1 regulates erastin-induced ferroptosis via RAS-JNK/p38 signaling in HL-60/NRAS Q61L cells

doi:

Figure Lengend Snippet: HMGB1 regulates TfR1 expression in the RAS-JNK/p38-dependent pathway. A. HL-60/NRASQ61L cells were lysed after treatment with erastin (5 μM) and/or Fer-1 (1 μM), then TfR1 expression was verified by western blot. B. HL-60/NRASQ61L cells were transfected with TfR1 siRNA and control siRNA, and TfR1 expression was verified by western blot. Then the two groups of cells were stimulated with erastin at the indicated doses for 48 h. Cell viability was assayed. Ctrl, control. (n = 3, *P < 0.05 versus the control group). C. HL-60/NRASQ61L cells were treated with erastin (5 μM) combined with SP600125 (10 μM) and SB202190 (10 μM) for 48 h. TfR1 expression and the phosphorylation of p38 (p-P38) and JNK1/2 (p-JNK1/2) were assayed by western blot. D. HL-60/NRASQ61L cells were transfected with NRAS siRNA and control siRNA vector, and NRAS expression was verified by western blot. Then two groups of cells were stimulated with erastin (5 μM) for 48 h. TfR1, p-P38 and p-JNK1/2 were assayed by Western blot. Ctrl, control. E. HL-60/NRASQ61L cells were transfected with HMGB1 shRNA (HMGB1 shRNA1 and HMGB1 shRNA2) and control shRNA vector and then stimulated with erastin (5 μM) for 48 h. TfR1, p-P38 and p-JNK1/2 expression levels were assayed by western blot. F. HL-60/NRASQ61L cells were transfected with HMGB1 plasmid and empty vector, and HMGB1 expression was verified by western blot. Then, two groups of cells were stimulated with erastin (5 μM) combined with SP600125 (10 μM) and SB202190 (10 μM) for 48 h. TfR1 expression was assayed by western blot. Necrostatin-1 pretreatment was used in all experiments. All experiments were conducted in triplicate, and the data are presented as the mean ± SD. Fer-1, ferrostatin-1.

Article Snippet: Human SOD1-siRNA (Target sequence: GGUGGAAAUGAAGAAAGUAC), human NRAS-siRNA (Target sequence: GUGUGAUUUGCCAACAAGG) and human TfR1-siRNA (Target sequence: CTGACTGCTCTCAGCTC) (GeneCopoeia, Guangzhou, China) were transfected into cells using Lipofectamine RNAiMAX reagent (for siRNA) according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA).

Techniques: Expressing, Western Blot, Transfection, Plasmid Preparation, shRNA

Journal: American Journal of Cancer Research

Article Title: HMGB1 regulates erastin-induced ferroptosis via RAS-JNK/p38 signaling in HL-60/NRAS Q61L cells

doi:

Figure Lengend Snippet: Knockdown of HMGB1 expression inhibited anticancer activity of erastin in vivo. A-C. NOD/SCID mice were injected subcutaneously with HMGB1 shRNA1 HL-60/NRASQ61L cells (1 × 106 cells/mouse) and treated with erastin (20 mg/kg i.v., twice every other day) starting at day seven for two weeks. Tumor volumes and animal weight were measured twice a week. At the termination of the experiments, all xenografts were removed and weighted (n = 4 mice/group, *P < 0.05, **P > 0.05, #P > 0.05). D and E. qPCR analysis of PTGS2 and TfR1 gene expressions in isolated tumors at the termination of experiments (*P < 0.05, **P > 0.05). F. Immunohistochemical staining of TfR1 was performed with an isolated tumor at the termination of the experiments. All experiments were conducted in triplicate, and the data are presented as the mean ± SD.

Article Snippet: Human SOD1-siRNA (Target sequence: GGUGGAAAUGAAGAAAGUAC), human NRAS-siRNA (Target sequence: GUGUGAUUUGCCAACAAGG) and human TfR1-siRNA (Target sequence: CTGACTGCTCTCAGCTC) (GeneCopoeia, Guangzhou, China) were transfected into cells using Lipofectamine RNAiMAX reagent (for siRNA) according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA).

Techniques: Expressing, Activity Assay, In Vivo, Injection, Isolation, Immunohistochemical staining, Staining

Journal: Nature Communications

Article Title: Plasma-derived extracellular vesicles from Plasmodium vivax patients signal spleen fibroblasts via NF-kB facilitating parasite cytoadherence

doi: 10.1038/s41467-020-16337-y

Figure Lengend Snippet: a BCA (protein concentration) of circulating EVs from healthy donors ( h EVs) and P. vivax patients ( Pv EVs) ( n = 10, individual samples). Data show mean ± SD. Two-sided, Mann–Whitney test, * p = 0.0232 (GraphPad). b P. vivax proteins identified by different unique peptides (sequences below the description of corresponding proteins). UniProtKB accession numbers and gene name corresponding to the P. vivax PvP01 strain are shown. c Western blot analysis of Pv EVs obtained from different individual patients (Pv1-7 and Pv10) and human donors (H1 and H3) using anti P. vivax MSP3.1 (upper membrane) and PHISTc (bottom membrane) antibodies. MSP3.1 and PHISTc recombinant truncated-proteins fused to GST, were used as positive controls. Molecular weight in kDaltons (kDa) is shown to the left. M: molecular size marker. Image representative of three independent experiments. d Nanoparticle tracking analysis (NTA) profile (size [nm] versus concentration [particles/mL]) of pooled h EVs and Pv EVs was analysed using NanoSight LM10-12. Table shows mean of three measurement of pooled h EVs and Pv EVs quantified by NTA (particles concentration) and BCA (protein concentration). e Beads-based flow cytometry analysis of pooled h EVs and Pv EVs using six EV markers (CD9, CD63, CD81, GAL3, CD5L and CD71). Data show median fluorescence intensity (MFI) of each antibody and control antibodies (rabbit and mouse-isotype) ± SD (technical replicates, n = 3). Unpaired and two-sided, t -test ** p = 0.0032 (CD63), *** p = 0.0006 (CD81, CD71), **** p < 0.0001 (CD9) (GraphPad). Source data are provided as a Source data file and Supplementary Data , and .

Article Snippet: Further, cells were stained using the following antibodies: CD90-PE/Cy7 [5E10] (Biolegend, Cat#328124) 1/100; CD44-FITC [KM201] (Abcam Cat#ab25340) 1/100; CD54-Alexa Fluor® 488 [HCD54] (Biolegend, Cat#322714) 1/400; CD71-PE [AC102] (Miltenyi Biotec, Cat#130-091-728) 1/400; CD45-PerCP [2D1] (BD Biosciences, Cat#345809) 1/50.

Techniques: Protein Concentration, MANN-WHITNEY, Western Blot, Membrane, Recombinant, Molecular Weight, Marker, Concentration Assay, Flow Cytometry, Fluorescence, Control